[Apostila] Bioquímica e Biologia Molecular - USP

[Apostila] Bioquímica e Biologia Molecular - USP

(Parte 1 de 9)

Indivíduo

Sondas

QBQ-217 BIOQUÍMICA E BIOLOGIA MOLECULAR DO GENE 2003

Profa. Suely Lopes Gomes (Coordenadora) Profa. Aline Maria da Silva

QBQ-217/Bioquímica e Biologia Molecular do Gene – 2003

QBQ-217

Bioquímica e Biologia Molecular do Gene Ciências Farmacêuticas, 2003 - Diurno

DOCENTES RESPONSÁVEIS: Profa. Suely Lopes Gomes (Coordenadora, sala 1211 - Bloco 12 inferior) Profa. Aline Maria da Silva (sala 1224 - Bloco 12 inferior)

MONITORES: Karina F. Ribichich Daniela Beton

HORÁRIO E SALAS: Aulas Expositivas: 4as. e 5as. feiras das 14 às 16hs - Sala 10 - Bloco 6 inferior Exercícios (Discussão): 4as. e 5as. feiras das 16 às 18 hs - Salas 9 e 10 - Bloco 6 inferior Aulas Práticas: Bloco 7 superior

O Curso envolve aulas expositivas, períodos para resolução e discussão de exercícios e aulas práticas. Utilizando as informações das aulas expositivas e a bibliografia recomendada, os alunos deverão resolver os exercícios. Os exercícios serão discutidos nos períodos de discussão em sala de aula com acompanhamento das professoras e monitores.

Nas aulas práticas serão realizadas experiências que envolvem algumas técnicas utilizadas na Biologia Molecular. Os alunos serão divididos em grupos e cada aluno deverá apresentar um

RELATÓRIO INDIVIDUAL contendo os resultados obtidos e a resolução das questões correspondentes. Só serão aceitos relatórios de alunos que realizaram as aulas práticas. POR RAZÕES DE SEGURANÇA, O USO DO AVENTAL NAS AULAS PRÁTICAS É OBRIGATÓRIO.

A avaliação será feita através da média ponderada das notas obtidas nas três provas (P1, P2 e

P3), nos relatórios (R) e na participação nos períodos de discussão de exercícios (E), de acordo com a fórmula abaixo:

A matéria das provas será CUMULATIVA. No final do curso, será oferecida uma prova substitutiva (com toda a matéria) para alunos que faltarem a uma das três provas (apresentar justificativa) ou que não atingiram média ≥ 5,0. Os alunos que não atingirem média ≥ 5,0, porém atingirem média ≥ 3,0 e 75% de frequência poderão realizar a prova de recuperação no segundo semestre de 2003.

A FREQUÊNCIA OBRIGATÓRIA MINÍMA ÀS AULAS É DE 75%.

BIBLIOGRAFIA RECOMENDADA: - Biologia Molecular Básica (2000) A. Zaha (Coordenador) Ed. Mercado Aberto

- Biochemistry (1995) L.Stryer. 3rd & 4th edition. W.H.Freeman and Co. New York.

- Recombinant DNA (1992) J.Watson, M.Gilman, J.Witkowski & M.Zoller. Ed. Scientifc American Books.

- Guia de Rotas na Tecnologia do Gene (1999), M. R. Walker & R. Rapley, Atheneu Editora São Paulo.

QBQ-217/Bioquímica e Biologia Molecular do Gene – 2003

CRONOGRAMA QBQ-217

19/02. 4a. feira - Estrutura e Função dos Ácidos Nucleicos. 20/02. 5a. feira - Fluxo da Informação Genética. Exercício I. 26/02. 4a. feira - Estrutura do DNA e Replicação. Exercício I. 27/02. 5a. feira – Reação em cadeia da polimerase (PCR). Exercício I. 05/03. 4a. feira – Não haverá aula (Cinzas). 06/03. 5a. feira – Mutação e Reparo. Exercício I. 12/03. 4a. feira – Experiência 1: Extração de DNA de E. coli. 13/03. 5a. feira - Plasmídeos e transposons. Exercício IV. 19/03. 4a. feira – Experiência 2: Transformação de bactérias com plasmídeos. 20/03. 5a. feira – Explorando os genes: clonagem de DNA. Exercício IV. 26/03. 4a. feira - Síntese e Processamento de RNA. Exercício V. 27/03. 5a. feira - Código Genético. Exercício VI. 02/04. 4a. feira - PROVA I. 03/04. 5a. feira - Síntese proteica. Exercício VII. 09/04. 4a. feira - Controle da Expressão Gênica em Procariotos I. Exercício VII. 10/04. 5a. feira – Controle da Expressão Gênica em Procariotos I. Exercício VII. 16/04. 4a. feira – SEMANA SANTA (Não haverá aula). 17/04. 5a. feira - SEMANA SANTA (Não haverá aula).

23/04. 4a. feira - Experiência 3: Indução da β-galactosidase por IPTG. 24/04. 5a. feira - Cromossomos de Eucariotos. Exercício VIII. 30/04. 4a. feira - Controle da Expressão Gênica em Eucariotos. Exercício IX. 1º/05. 5a. feira – DIA DO TRABALHO (Não haverá aula). 07/05. 4a. feira - Mecanismos de Transdução de sinal. Exercício IX. 08/05. 5a. feira - Oncogenes e câncer. Exercício X. 14/05. 4a. feira - Exercício X/Plantão de Dúvidas. 15/05. 5a. feira - PROVA I 21/05. 4a. feira - Reunião Anual da SBBq (Não haverá aula). 2/05. 5a. feira - Análise de Genomas I e I. 28/05. 4a. feira – Experiência 4: Preparação de DNA plasmidial. 29/05. 5a. feira - Análise de Genomas I. Exercício XI

04/06. 4a. feira - Experiência 5: Digestão de DNA e eletroforese em gel de agarose.

05/06. 5a. feira – Proteínas Recombinantes/Transgênicos. Exercício XII. 1/06. 4a. feira - Experiência 6: Expressão de proteína recombinante em E. coli. 12/06. 5a. feira – Diagnóstico clínico através do DNA/Terapia Gênica. 18/06. 4a. feira – Exercício XIII. 19/06. 5a. feira – CORPUS CHRISTI (Não haverá aula). 25/06. 4a. feira – PROVA I 26/06. 5a. feira – Período de estudo. 02/07. 4a. feira – PROVA SUBSTITUTIVA

QBQ-217/Bioquímica e Biologia Molecular do Gene – 2003

I. Estrutura e Função dos Ácidos Nucleicos

1. Quais as diferenças de composição e estrutura entre RNA e DNA. Como se distingue entre a uracila e a timina, e entre a ribose e a desoxirribose.

2. Escreva os nomes das bases, ribonucleosídeos, desoxirribonucleosídeos, ribonucleotídeos e desoxirribonucleotídeos do DNA e RNA.

3. Escreva a sequência de bases da fita complementar do DNA dupla fita que apresenta uma fita com a sequência: (5') ATGCCGTATGCATTGCATTC (3') Exprima, em porcentagem, a composição de bases do DNA de fita dupla.

4. Como são chamadas as ligações covalentes que unem dois nucleotídeos consecutivos nas moléculas de ácidos nucleicos? Esquematize estas ligações.

5. Uma molécula de ácido nucleico tem a seguinte composição de bases: C = 24,1% G = 18,5% T = 24,6% A = 32,8% O que você pode afirmar sobre esta molécula?

6. Explique por que ácidos nucleicos são desnaturados quando submetidos a alta temperatura ou pHs extremos ? Uma molécula de DNA desnaturada por aquecimento pode ser renaturada? Como?

7. O valor de Tm para o DNA pode ser calculado usando-se a fórmula :

Tm = 69,3 + 0,41(%GC), onde GC é a porcentagem de Guanina + Citosina a) DNA de E. coli contém 50% GC. Calcular o Tm para o DNA desta bactéria. b) As curvas de fusão da maioria dos DNAs que ocorrem naturalmente revelam que o Tm é normalmente maior do que 65oC. Por que isto é importante para a maioria dos organismos? c) Como varia o Tm com a força iônica da solução? d) O que acontece com Tm quando se adiciona etanol à solução de DNA?

8. Descreva os principais experimentos que indicaram que o DNA é o material genético.

9. Descreva o experimento de Meselson-Stahl. Qual seria o resultado deste experimento se a replicação do DNA fosse conservativa?

10. Quais os diferentes tipos de RNA que podem ser encontrados nas células? Quais as suas funções principais?

QBQ-217/Bioquímica e Biologia Molecular do Gene – 2003 I. Fluxo da Informação Genética

1. Após a infecção de E. coli com o bacteriofago T2, quais dos seguintes eventos ocorrem e em que ordem ?

(a) novas proteínas são sintetizadas
(b) novos RNAS são sintetizados
(c) novos ribossomos são sintetizados
(d) novos RNAS se associam a novos ribossomos
(e) novos RNAS se associam a ribossomos pré-existentes

2. RNA é facilmente hidrolizado por álcali, enquanto DNA não o é. Por que? 3. Uma fita de um fragmento de DNA isolado de E. coli tem a seguinte sequência

5'...AGGTTACCTAGTTGC...3'

Suponha que um mRNA seja transcrito a partir deste DNA usando a fita complementar como molde. Qual será a seqüência deste mRNA? O que você pode dizer sobre a capacidade de formação de um híbrido RNA-DNA?

4. Qual é a sequência do polipeptídeo que seria codificado pelo mRNA sintetizado na questão 3. Assuma que o quadro de leitura começa com o primeiro nucleotídeo.

5. Quais os diferentes tipos de RNA que podem ser encontrados nas células e como eles se diferenciam quanto à estrutura, tamanho, abundância e função?

6.Baseando-se na lista de códons e amino ácidos abaixo, quais das seguintes afirmações são corretas?

AGU = serina AGC = serina AAU = asparagina AAC = asparagina AUG = metionina AUA = isoleucina

(a) o código genético é degenerado (b) a alteração de um único nucleotídeo no DNA que dirige a síntese destes códons poderia levar à substituição de uma serina por uma asparagina no polipeptídeo. (c) a alteração de um único nucleotídeo no DNA que dirige a síntese destes códons necessariamente levaria à substituição de um aminoácido no polipeptídeo codificado. (d) um tRNA com o anticódon ACU se ligaria a um ribossomo na presença de um destes códons.

(Parte 1 de 9)

Comentários