EXPRESSÃO, PURIFICAÇÃO E CRISTALIZAÇÃO DE UMA SER THR QUINASE lnls

EXPRESSÃO, PURIFICAÇÃO E CRISTALIZAÇÃO DE UMA SER THR QUINASE lnls

(Parte 1 de 4)

19º PROGRAMA BOLSA DE VERÃO 2010 DANIEL PEREIRA DUARTE ORIENTADOR DR. MARTIN WURTELE

FEVEREIRO DE 2010 CAMPINAS - SP

Resumo4
Abstract6
Introdução8

SUMÁRIO !1.1 Fosforilação

!1.2 Importância Fisiológica

!1.3 Serina/Treonina quinases e fosfatases

Objetivos16
Material e Métodos17

!1.4 Acidothermus cellulolyticus !2.1 Preparação dos plasmídeos recombinantes

!2.2 Transformação e Sequenciamento

!2.4 Lise celular

!2.5 Purificação e diálise

!2.6 Clivagem e finalização

Resultados25

!2.7 Screenning manual !3.1 Clonagem dos genes

!3.2 Teste de expressão

!3.3 Purificação em coluna de afinidade

!3.4 Gel filtração

Conclusão38
Referências Bibliográficas39
Anexo 141
Anexo 243

!A fosforilação reversível de resíduos de proteínas é um importante recurso utilizado por todos os seres vivos para a regulação dos processos biológicos frente a estímulos ambientais. Através das Ser/Tre quinases os resíduos de hidroxiaminoácidos serina e treonina recebem uma molécula de fosfato (PO4 ), alterando a carga dessas regiões e modificando a estrutura nativa, enquanto as Ser/Tre fosfatases catalisam a reação inversa. Por muitos anos acreditou-se que a fosforegulação não era um mecanismo importante no controle fisiológico em procariotos, porém recentemente descobriu-se que esses organismos também utilizam essa ferramenta para autorregulação, assim como já amplamente conhecido nos eucariotos. As quinases e fosfatases estão envolvidas com processos de transdução de sinais e sinalização celular que controlam os diversos processos biológicos, tais como ciclo celular, interação parasitahospedeiro, adesão, alteração do citoesqueleto, migração, diferenciação e comunicação celular. Da mesma forma, em procariotos elas estão intimamente ligadas à virulência de microoganismos patogênicos, como já caracterizado em Mycobacterium tuberculosis, por exemplo. Os sítios ativos de tais enzimas possuem importantes diferenças em relação ao de eucariotos, despertanto grande interesse para a área médica, visto que o desenho de inibidores específicos seria uma ferramenta ímpar na quimioterapia antibacteriana. Em 2006 foi concluído o genoma da bactéria termófila Acidothermus cellulolyticus. Por homologia, verificou-se que esse organismo possui diversos genes “eukaryoticlike” semelhantes a outros previamente caracterizados como moduladores de grupos fosfato. O obetivo deste trabalho foi caracterizar, expressar, purificar e cristalizar duas proteínas de A. cellulolyticus, visando futuramente compreender melhor a estrutura e mecanismo catalítico dessa classe de enzimas em procariotos. Os domínios catalíticos das enzimas Ser/Tre quinase (Acel_0019) e Ser/Tre fosfatase (Acel_0022) foram amplificados, clonados em vetor pQTEV, sequenciados e expressos em Escherichia coli BL21. As proteínas foram isoladas 4 utilizando uma coluna de afinidade com matriz Ni-NTA, dialisadas e purificadas por gel filtração. Após, a cauda de histidina foi clivada utilizando a protease TEV recombinante e a proteína novamente purificada por afinidade e gel filtração. O domínio Ser/Tre quinase expressado possuía 3,36 kDa enquanto a Ser/Tre fosfatase 25,31 kDa. Utilizando kit de screening, realizou-se testes de cristalização utilizando várias combinações de tampões e precipitantes. Alguns tampões apresentaram características positivas para formação de cristais, porém não houve formação de um cristal ideal para difração de raios-X e a obtenção de uma estrutura tridimensional. Um tempo maior de espera é necessário para formação de estruturas cristalográficas estáveis e ideais, além de um refinamento dos componentes dos tampões que obtiverem um efeito satisfatório durante o processo.

!The reversible phosphorylation of aminoacids residues is an important resource used by most organisms to control biological processes face to environmental stimuli. Through Ser/Thr kinases, serine and threonine hydroxiaminoacids residues receive one molecule of phosphate (PO4 ), changing the charge of these regions and modifying the native structure, while the Ser / Tre phosphatases catalyze the reverse reaction. For many years it was believed that the fosforegulation was not an important mechanism in the physiological control in prokaryotes, but it was recently found that these organisms also use this tool for self-regulation, as has been widely studied in eukaryotes. The kinases and phosphatases are involved in processes of the signal transduction and cellular signaling that controls many biological processes such as cell cycle, host-parasite interactions, adhesion, changes in the cytoskeleton, migration, differentiation and cell communication. Similarly, in prokaryotes it is closely linked to virulence of pathogenic microorganisms, as characterized in Mycobacterium tuberculosis, for example. The active site of these enzymes have important differences from that of eukaryotes, arousing great interest to the medical field, since the design of specific inhibitors would be a unique tool in antibacterial chemotherapy. In 2009 it had been completed the genome of the thermophilic bacteria Acidothermus cellulolyticus. By homology, it was found that this organism has several eukaryoticlike genes similar to other previously characterized as a modulator of phosphate groups. The purpose of this study was to characterize, express, purify and crystallize two proteins of A. cellulolyticus in order to better understand the structure of this class of enzymes in prokaryotes. Using the tools of molecular biology, the catalytic domains of enzymes Ser / Tre kinase (Acel_0019) and Ser / Tre phosphatase (Acel_0022) were amplified, cloned into pQTEV vector, sequenced and expressed in Escherichia coli BL21(DE3). Proteins were isolated using affinity column with Ni-NTA matrix, dialyzed and purified by gel filtration.

After the his-tag was cleaved using recombinant TEV protease and again purified 6 by affinity cromatography and gel filtration. The Ser/Thr kinase domain has 3.36 kDa while Ser/Thr phosphatase 25.31 kDa. Using crystalization screening kit, the test was carried out using various combinations of buffers and precipitants. Some buffers had positive characteristics for the development of crystals, however an ideal crystal for diffraction X-ray and acquisition of three-dimensional structure was not obtained. A longer period is required for the development of a stable and ideal crystallographic structure, beyond an improvement of the buffer components that have obtained a satisfactory effect in the process.

!Nos últimos anos, a crescente facilidade na obtenção e o mau uso de quimioterápicos antibióticos tem levado ao aparecimento de diversos casos de tolerância e resistência por parte dos microorganismos infecciosos. A busca por alvos alternativos e o desenho racional de inibidores contra esses patógenos tem ganhado grande importância na saúde e bem estar de humanos e animais. Um alvo ideal é aquele que possui um inibidor eficiente que impede o funcionamento normal de uma via metabólica essencial ao micro-organismo, consequentemente inviabilizando sua sobrevivência. Além disso, esse alvo deve estar ausente ou modificado no hospedeiro, além da droga inibidora possuir um nível tolerável de toxicidade (Bugg, 2004). Recentemente com advento de novas técnicas em biologia molecular estrutural, muitas macromoléculas estão tendo suas estruturas solucionadas, facilitando o desenho e modificação de moléculas inibidoras.

!Diversos são os mecanismos utilizados pelos seres vivos para autorregulação e sobrevivência frente a mudanças e estímulos externos e internos, como fosforilação, controle do fluxo de íons, liberação de sinalizadores e mensageiros, entre outros (Kraus, 2003). A fosforilação apresenta-se como um mecanismo ímpar e onipresente no controle e sinalização celular.

1.1 Fosforilação

!A habilidade de modificar a ação de enzimas é o principal mecanismo da regulação celular em resposta a estímulos internos e externos, direcionando a atividade de redes metabólicas que controlam os processos fisiológicos da célula.

!A fosforilação de resíduos de hidroxiaminoácidos de proteínas é uma modificação pós-traducional presente em praticamente todos os seres vivos conhecidos. Ligado covalentemente às hidroxilas dos resíduos dos aminoácidos serina, treonina, tirosina, histidina e aspartato (Johnson & Lewis, 2001), o grupo fosfato altera a estrutura nativa da proteína, ativando-a ou inativando-a. Esse fato deve-se as propriedades especiais do

PO4 , que possui um pKa de 6,7 e carrega duas cargas negativas quando em pH neutro, isto é, ele gera duas cargas negativas na cadeia lateral do aminoácido fosforilado, como exemplificado na Figura 1. Devido a presença desse fosfato e de quatro átomos de oxigênio, ocorre forte interação através do hidrogênio de outros resíduos, permitindo que ocorram ligações entre diferentes regiões da cadeia carbônica. Grupos duplamente carregados com carga negativa não ocorrem em outros elementos estruturais de proteínas. Os ésteres de fosfato de serina, treonina e tirosina são bastante estáveis a temperatura ambiente e pH neutro; raramente hidrolisam espontaneamente. Por esse motivo, esse processo de fosforilação reversível é catalisado por enzimas quinases que incorporam fosfato (proveniente de uma molécula de ATP) através de sua atividade de fosfotransferase e por enzimas fosfatases que o hidrolizam (Kraus, 2003). A Figura 2 exemplifica a ativação ou inativação de proteínas através da atividade dessas enzimas.

Fig. 1 - Mudança na carga de proteínas através da fosforilação. A fosforilação de resíduos de Ser (acima) e Tre (abaixo) é catalisada por quinases específicas que utilizam ATP como doador de fosfatos. O produto da reação é uma Ser/Tre fosforilada que possui duas cargas negativas em pH neutro (Kraus, 2003).

Fig. 7.1 Amino acid specificity of protein kinases.

7 Ser/Thr-specific Protein Kinases and Protein Phosphatases270

Fig. 2 - A função de proteínas quinases e fosfatases. De acordo com a proteína alvo, sua fosforilação pode ativar ou inativar sua função. No caso de P1, a fosforilação a torna ativa, enquanto o contrário é válido para P2 (Kraus, 2003).

logous with respect to the sequence of the catalytic domain, whereas PP2C appears to have a distinct evolutionary background. Generally, the protein phosphatases are made up of a catalytic subunit with one or more associated subunits that have regulatory and/or targeting functions.

7.6.2 Regulation of Ser/Thr Protein Phosphatases

Protein phosphatases are the antagonists of protein kinases. They perform a dual function. By diminishing and terminating a signal created by protein phosphorylation, they can have a damping effect on protein kinase-mediated signal transduction. Protein phosphatases can also have a positive, reinforcing effect in signaling pathways. Dephosphorylation of a signal protein by a protein phosphatase can lead to its activation and thus to amplification of the signal (Fig. 7.15).

Because of these functions, the protein phosphatases are an indispensable part of signal transduction processes involving protein phosphorylation. It is therefore not surprising that the protein phosphates are subject to diverse and complex regulation. A large part of this regulation is exerted via additional subunits that associate with the catalytic subunit to form the active holoenzyme. These subunits serve to transmit incoming signals to the catalytic subunit and to target the catalytic subunit to distinct subcellular sites.

Regulation of the Ser/Thr phosphatases takes place predominantly by the following mechanisms:

Fig. 7.15 The dual function of protein kinases and protein phosphatases. Phosphorylation of proteins (P1, P2) can fix the latter into an active or inactive state. In the case of P1, protein kinases have an activating effect and protein phosphatases are inactivating; the reverse is true for P2.

7.6 Ser/Thr-specific Protein Phosphatases 297297

!Estudos com interações proteína-proteína demonstraram que os grupos fosfato interagem com nitrogênios presentes na cadeia principal do início de α-hélices, onde frequentemente glicina é encontrada. Já em interações sem α-hélices, os grupos fosfatos normalmente interagem com resíduos de arginina (Kraus, 2003).

!De acordo com a especificidade da estrutura dos aminoácidos, a fosforilação é realizada por enzimas que fosforilam serinas e treoninas ou tirosinas, dividindo essas enzimas em quatro grupos principais: as Ser/Tre e Tir quinases e fosfatases.

!Até recentemente, acreditava-se que a fosforilação de serinas/treoninas e tirosinas era um evento exclusivo de eucariotos, enquanto apenas a fosforilação de histidinas e aspartato estavam presentes em procariotos (Johnson & Lewis, 2001; Kennelly & Potts, 1996; Wolanin et. al., 2002). Entretando, com o avanço da ciência, especialmente genômica, descobriu-se que procariotos possuem genes de proteínas quinases e fosfatases de Ser/Tre e Tir eukaryotic-like (Shi et al, 1998), com estrutura e função semelhante a enzimas eucarióticas, porém com sequências primárias variávies.

!1.2 Importância Fisiológica

!As Ser/Tre quinases e fosfatases têm demostrado participar de diversos eventos fisiológicos em procariotos, como diferenciação morfológica e metabolismo (Umeyeama et. al., 2002), resposta a estresse oxidativo (Neu et. al., 2002), transporte de açúcares (Deutscher & Saier, 1983), metabolismo da glicose (Nariya & Inouye, 2002, 2003), crescimento celular (Treuner-Lange et. al., 2001), viabilidade celular (Gaidenko et. al., 2002), esporulação (Madec et. al., 2002), entre outros.

!Proteínas quinases e fosfatases presentes em procariotos estão intimamente relacionadas a dois sistemas fisiológicos principais: fosfoenolpiruvato (PEP) carboidrato fosfotranferase (phosphoenolpyruvate carbohydrate phosphotranferase - PTS) e sistema de duplo componente (two component system - TCS). Os sistemas PTSs promovem a incorporação de fosfatos à carboidratos de superfície, permitindo a translocação e retenção dos mesmos na membrana citoplasmática (Postma et. al., 1993).

!Já os sistemas TCSs são compostos por uma proteína receptora histidina quinase que sinaliza para fosforilação de um regulador de resposta que controla diretamente a expressão gênica perante estímulos ambientais (Stock et al., 2000; West & Stock, 2001).

A expressão de alguns fatores de virulência é em alguns casos controlada por TCSs. Em Salmonella, por exemplo, o PhoP-PhoQ TCS é o principal regulador de fatores de viruência (Beier & Gross, 2006). Experimentos utilizando géis bidimensionais revelaram que um acréscimo na concentração de cátions divalentes, como cálcio e magnésio, ativam esse sistema, controlando a expressão de mais de 40 diferentes proteínas (Véscovi et al., 1994). Apesar da denominação, o TCSs não é composto por apenas dois compenentes, porém o que define esse sistema é a presença do sensor histidina quinase e seu respectivo regulador de resposta (West & Stock, 2001).

!A resistência a diversos antibióticos e fatores de defesa do hospedeiro ocorre algumas vezes devido a presença de moléculas de lipopolissacarídeos (LPS) na membrana externa de bactérias Gram negativas. Yethon et al. (1998) demonstraram que as quinases WaaY e WaaP são responsáveis pela fosforilação dos LPS em Escherichia coli. Esses exopolissacarídeos também impedem a fagocitose por macrófagos e a ação de neutrófilos, além de inibir o sistema complemento.

!1.3 Serina/Treonina quinases e fosfatases

!As proteínas Ser/Tre quinases possuem um domínio catalítico comum de aproximadamemnte 280 aminoácidos, possuindo 12 subdomínios numerados de I-V, VIa, VIb, e VII-XI (Shi et al., 1998). A conservação absoluta é rara, porém 12 resíduos estão quase sempre presentes. A primeira fosfoproteína de procarioto caracterizada foi a isocitrato dehidrogenase de Escheria coli, em 1979, por Garnak & Reeves (1979). Surpreendentemente, essa enzima bifuncional (quinase/fosfatase) não exibia nenhuma sequência similar a quinases eucarióticas. Esse fato despertou enorme interesse nos últimos anos, visto que através do desenho de inibidores de proteínas específicas de procariotos, seria possível o desenvolvimento de novas moléculas para antibioticoterapia.

! Outro fato interessante é o de que no genoma de bactérias Gram-negativas, os genes das quinases e suas respectivas fosfatases encontram-se relativamente próximos e em muitos casos um seguido do outro, favorecendo sua expressão coordenada e consequentemente o controle sobre os substratos correspondentes (Kennelly, 2002). Entretando, no genoma de Gram-positivas, os genes do par de enzimas estão geralmente separadas por dois genes necessários para a atividade da quinase. Geralmente esses grupos de genes fazem parte de um grande operon para coordenar a biossíntese, processamento ou regulação de polissacarídeos extracelulares.

!1.4 Acidothermus cellulolyticus

!Recentemente, com advento de novas técnicas em genômica e as facilidades de manuseio de grandes volumes de informação através da bioinformática, centenas de genomas inteiros foram sequenciados e estão disponíveis em bancos de dados virtuais. Em 2009, Barabote et. al. sequenciaram o genoma da actinobactéria Acidothermus cellulolyticus. Esse microorganismo Gram-positivo foi isolado em fontes hidrotermais no parque nacional de Yellowstone, EUA (Mohaguegui et. al., 1986). A bactéria termófila, com crescimento ótimo em cerca de 55ºC, apresentou um repertório de enzimas com possível utilização para produção de biomassa, elevando o valor industrial desse organismo. Foram encontrados 2217 genes codificando 2157 proteínas, em um total de 2,4Mbp. Entre esses genes foi verificado, por homologia, a presença de várias candidatas a quinases e fosfatases eukaryotic-like.

aminoácidos (18-280), e apresenta-se destacado na sequência abaixo. As regiões

!O gene Acel_0019 possui 1746 pb, predizendo uma estrutura com atividade de serina/treonina quinase com 582 aminoácidos. O domínio catalítico é composto por 262 destacadas em verde indicam domínios PASTA, que são regiões transmembrana presentes em receptores de quinases em muitas bactérias Gram-positivas, como Mycobacterium tuberculosis. Esses receptores, classificados como PknB, são estruturas transmembrana que possuem um domínio extracelular receptor com múltiplos domínios PASTA e uma região intracelular que compreende um domínio com atividade de Ser/Tre quinase. Essas regiões PASTA são encontradas na extremidade C-terminal de diversas proteínas associáveis a penicilina (penicillin binding proteins - PBPs) e Ser/Tre quinases de bactérias. O nome PASTA é derivado de PBS e domínio associado a Ser/Tre quinase (Ser/Thr kinase associated domain). A proteína possui um peso molecular total de 61,434 kaDa.

!Sequência de Acel_0019 (GeneID 4484678) - proteína Ser/Thr quinase: GTGACGAGCAACGACTCGCTGACAAACCAGCCGCGGCGCATCCTCGCCGACCGATATGAACTCGGC GAAATCCTCGGCTACGGCGGGATGGCTGAGGTACGCCGGGGCCGTGATCTCCGCTTGGGCCGCGAC

(Parte 1 de 4)

Comentários